We've just migrated to a new address! Please update your bookmarks!
Nomenclatures
| Features | Values | Descriptions |
|---|---|---|
| HGNC gene symbol (ID): | CFTR (1884) | HGNC gene symbol and corresponding ID |
| HGVS DNA on transcript: |
NM_000492.4:c.3719T>G
MD canonical
MANE Select
|
HGVS full nomenclature at DNA level on transcript |
| HGVS RNA: | r.(?) | HGVS full nomenclature at RNA level |
| HGVS Protein: | NP_000483.3:p.(Val1240Gly) | HGVS full nomenclature at protein level |
| HGVS genomic (hg19): | chr7(hg19):g.117282493T>G | HGVS full nomenclature at genomic level (hg19) |
| HGVS strict genomic (hg19): | NC_000007.13:g.117282493T>G | HGVS full strict nomenclature at genomic level (hg19) |
| pseudo VCF (hg19): | hg19-7-117282493-T-G | chr-pos-ref-alt (hg19) |
| HGVS genomic (hg38): | chr7(hg38):g.117642439T>G | HGVS full nomenclature at genomic level (hg38) |
| HGVS strict genomic (hg38): | NC_000007.14:g.117642439T>G | HGVS full strict nomenclature at genomic level (hg38) |
| pseudo VCF (hg38): | hg38-7-117642439-T-G | chr-pos-ref-alt (hg38) |
Positions
| Features | Values | Descriptions |
|---|---|---|
| Position in transcript: | Exon 23 | Exon/intron position in NM_000492.4 |
| Position / splice site | 2 bp from acceptor | Position relative to the nearest splice site |
| Position / protein | 1240 / 1479 | Position relative to the protein |
| Position / domain | ABC transporter 2 (1210 - 1443) | Position in a protein domain (UNIPROT: P13569) |
| Position tolerance | 0.98 : slightly tolerant - Transcript view | MetaDome score, the closer to 0, the more intolerant to variation |
| Wild type sequence | GATCCCATCACTTTTACCTTATAGG T GGGCCTCTTGGGAAGAACTGGATCA | Wild type DNA sequence +/- 25 bp |
| Mutant sequence | GATCCCATCACTTTTACCTTATAGG G GGGCCTCTTGGGAAGAACTGGATCA | Mutant DNA sequence +/- 25 bp |
Literature
LitVar2 : PubMed links of articles citing this variant
LitVar is a web service that allows the search and retrieval of variant
relevant information from the biomedical literature. LitVar uses advanced
text mining and machine learning techniques to normalize different forms
of the same variant into a unique and standardized name so that all
matching articles can be returned regardless of the use of a specific name
in the query. LitVar is freely available to the research community.
VarChat : use AI to summarize scientific literature for genomic variant interpretation
VarChat is an open platform that leverages the power of generative artificial intelligence to support the genomic variant interpretation process by searching and condensing the scientific literature available for each variant into a brief yet very infomative text.
- Get insights from pertinent scientific literature in seconds
- Stay up-to-date with the latest research on genomic variants
- Save a lot of time while receiving accurate and detailed genomic information
Alternative automated literature tools
- Mastermind : Search engine to identify gene, variant, disease, phenotype, and therapy evidence from scientific articles.
Population Frequencies and Databases
| Features | Values | Descriptions |
|---|---|---|
| gnomAD exome: | 3.985e-06 | v2.1.1 Exomes global MAF |
| gnomAD genome: | No match in gnomAD genome | v2.1.1 Genomes global MAF |
| gnomAD exome (non cancer): | 9.771e-06 | v2.1.1 Exomes MAX MAF for non-cancer dataset |
| gnomAD v4 Genome: | No match in gnomADv4 Genome | v4.1.0 Genomes global MAF |
| gnomAD v4 Exome: | 2.053e-06 | v4.1.0 Exomes global MAF |
| dbSNP rsid: | rs397508598 | Identifier for NCBI dbSNP |
| Clinvar Germline: | Pathogenic *** | Clinvar interpretation |
| ClinGen EvRepo: | Searching for ClinGen EvRepo data... | ClinGen Evidence Repository Classification for the variant |
| hg38 InterVar: | Asking Intervar... | Semi-automated ACMG classification - click on the intervar link to adjust - passing the mouse over a criterion will display the definition |
| GeneBe: | Asking GeneBe... | Semi-automated ACMG classification - click on the GeneBe link to adjust - passing the mouse over a criterion will display the definition |
| LOVD matches: | Searching LOVD... | LOVD match in public instances |
exon substitution +
Overall predictions
| Features | Values | Descriptions |
|---|---|---|
| CADD raw: | 5.18 | [-6.41;35.5] The higher the less likely to be observed |
| CADD phred: | 29.10 | Phred-like scaling of raw score |
| Eigen raw: | 0.84 | [-3.33;6.84] The higher the less likely to be observed |
| Eigen phred: | 9.66 | Phred-like scaling of raw score |
| MPA score: | 10 | Raw score [0;10], 10: high impact |
| MPA impact: | Clinvar pathogenic | Impact type |
Splicing predictions
Exonic context
The exonic splicing context of the variant including natural splice sites scores is summarized in the graph below:
MaxEntScan results
MaxEntScan scores are presented in the two following tables. Selected scores have:
- a |variation| > 15% and
- a raw score for mutant or wild-type of at least 3
| Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
|---|---|---|---|---|
| ... TAGGTGGGC
... ... TAGgtgggc ... |
5.26 | ... TAGGGGGGC
... ... TAGgggggc ... |
-2.39 | -145.44 |
| Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
|---|---|---|---|---|
| ... CCATCACTTTTACCTTATAGGTG
... ... ccatcacttttaccttatagGTG ... |
9.57 | ... CCATCACTTTTACCTTATAGGGG
... ... ccatcacttttaccttatagGGG ... |
8.06 | -15.78 |
SPiP results
SPiP results and predictions:
MobiDetails is running SPiPv2 (may last up to 20s)...
dbscSNV / SpliceAI / AbSplice Max results
This table presents dbscSNV and SpliceAI raw delta scores (max distance: 50 bp, for academic users), when available. You can also run spliceAI via the spliceAIlookup API using a distance of 500 bp, and get also raw delta scores. This may take a while especially for genes with multiple transcripts but may help you identify new deep intronic variants. This also gives the opportunity to get spliceAi scores for large insertions or deletions. Details on raw or masked delta scores are available here. While the authors state that masked scores are preferentially used for variant interprétation, raw scores (unmasked) seem to be more informative. You can get masked delta scores with a +/- 500 bp window with this link. For substitutions, a pre-computed score for AbSplice is diplayed when relevant. AbSplice associates SpliceAI, MMSplice and tissue-specific splice site annotations (SpliceMaps). The scores represent the probability that a given variant causes aberrant splicing in a given tissue.
| Features | Values | Descriptions |
|---|---|---|
| dbscSNV ADA: | 0.31 | Raw score 0-1, threshold ≥ 0.8 for impact |
| dbscSNV RF: | 0.52 | Raw score 0-1, threshold ≥ 0.8 for impact |
| spliceAI AG: | 0.00 (48) | Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI AL: | 0.14 (-1) | Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI DG: | 0.00 (-47) | Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI DL: | 0.00 (-2) | Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) AG: | SpliceAi 500 was not run | Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) AL: | SpliceAi 500 was not run | Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) DG: | SpliceAi 500 was not run | Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) DL: | SpliceAi 500 was not run | Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| AbSplice: | < 0.01 in v1.0.0 (dataset) | AbSplice Max Tissue score, thresholds ≥ 0.01|0.05|0.2 for impact |
Radar view of splicing predictors
Values are normalised (0-1), 0 being the less damaging and 1 the most for each predictor.
SpliceAI-visual results
SpliceAI-visual displays SpliceAI raw (absolute) predictions:
- Green and red highlights show the variation site on the wild-type and mutant track, respectively
- Positive orange bars represent predicted acceptor sites ([0;1]), and negative blue bars donor sites ([-1;0]), the spliceai raw score being the absolute value.
- The first track is the spliceai prediction for the entire MANE transcript.
- The second track is the prediction for the variant, +/- 10kb inside the transcript (i.e. not considering intergenic nucleotides).
- The "inserted nucleotides" track is used to display the scores of the nucleotides being part of the insertion (empty if no insertion)
- You can download the Wild-type and mutant bedgraphs in order to load them in your own Desktop IGV or the UCSC genome browser.
- Important notice: if your intronic variant is located more than 10kb from one of the two flanking exons, you are advised to click on the "SpliceAI-visual full transcript" button at the top of this text. Depending on the size of your transcript, within 30s-10 minutes (for the DMD gene, the bad news), the whole transcript prediction including the variant will appear as a new track in the igv.js browser, allowing a more accurate prediction for your variant. The good news being that if it has already been computed, it will load automatically.
- How to cite?
MobiDetails is running spliceai to bring you SpliceAI-visual...
Missense predictions: p.(Val1240Gly)
| Features | Values | Prediction | Descriptions |
|---|---|---|---|
| SIFT: | 0.001 | Damaging | Threshold < 0.05 for Damaging - single score |
| Polyphen 2 HumDiv: | 0.992 | Probably Damaging | Thresholds ≥ 0.454|0.957 for Possibly and Probably Damaging - single score |
| Polyphen 2 HumVar: | 0.944 | Probably Damaging | Thresholds ≥ 0.447|0.909 for Possibly and Probably Damaging - single score |
| Fathmm: | -3.58 | Damaging | Threshold ≤ -1.5 for Damaging - single score |
| AlphaMissense: | 0.564 | Ambiguous | Thresholds 0.34|0.564 for Likely Benign, Ambiguous, Likely Pathogenic - single score |
| REVEL: | 0.97 | Damaging | Thresholds 0.2|0.5 for Benign, Uncertain, Damaging - meta score |
| ClinPred: | 0.995 | Damaging | Threshold ≥ 0.5 for Damaging - meta score |
| Meta SVM: | 1.0794 (10) | Damaging | Threshold ≥ 0 for Damaging (reliabilty index: 0-10), 10:high - meta score |
| Meta LR: | 0.9274 (10) | Damaging | Threshold ≥ 0.5 for Damaging (reliabilty index: 0-10), 10:high - meta score |
| Mistic: | 0.68 | Damaging | Threshold ≥ 0.5 for Damaging - meta score |
Radar view of missense predictors
Values are normalised (0-1), 0 being the less damaging and 1 the most for each predictor.
Mean normalised score of all single predictors: 0.806 (4.029 / 5) - for meta predictors: 0.838 (4.192 / 5)
3D Modeling: p.(Val1240Gly)
Let's try this direct access to MIZTLI's 3D engine to compare the wild-type and mutant structure of your variant.
Classification History
| Variant | User | Date | ACMG Classification* | Comments |
|---|---|---|---|---|
| NM_000492.4(CFTR):c.3719T>G
Current
|
CFTR-France | 2022-10-07 | Class 5 (pathogenic) |
To modify the classification history, you must be logged in (you might want to create an account before).
* We added an additional 'risk factor' class to the 5 ACMG classes in order to describe low penetrance risk factor variants. Currently, these variants are not sent to the LOVD Global Variome instance.
Administrative information
| Features | Values | Descriptions |
|---|---|---|
| Creation user: | CFTR-France | User who created the variant |
| Creation date: | 2022-10-06 | Date of creation in MD |
mobidetails
To contact the creation user, you must be logged in (you might want to create an account before).