IMPORTANT NOTICE:
MobiDetails' migration to the new instance is scheduled for March, 19th, morning. The current instance will first be placed on read-only mode during the switch, which should last a few hours, and which means you will be able to consult already annotated variants but not annotate new ones. A redirection to the new instance will be activated when it is ready.
This variant may be annotated on the current canonical isoform (NM_000492.4) using the following expression,
directly in the search engine at the bottom of the page or by using the blue button below:
NC_000007.14:g.117627651_117627652delinsG;CFTR
Try annotation on the canonical NM_000492.4 Annotating the variant on NM_000492.4
Features | Values | Descriptions |
---|---|---|
HGNC gene symbol (ID): | CFTR (1884) | HGNC gene symbol and corresponding ID |
HGVS DNA on transcript: |
NM_000492.3:c.3598_3599delinsG
RefSeq Select
|
HGVS full nomenclature at DNA level on transcript |
HGVS RNA: | r.(?) | HGVS full nomenclature at RNA level |
HGVS Protein: | NP_000483.3:p.(Lys1200GlufsTer11) | HGVS full nomenclature at protein level |
HGVS genomic (hg19): | chr7(hg19):g.117267705_117267706delinsG | HGVS full nomenclature at genomic level (hg19) |
HGVS strict genomic (hg19): | NC_000007.13:g.117267705_117267706delinsG | HGVS full strict nomenclature at genomic level (hg19) |
pseudo VCF (hg19): | hg19-7-117267705-AA-G | chr-pos-ref-alt (hg19) |
HGVS genomic (hg38): | chr7(hg38):g.117627651_117627652delinsG | HGVS full nomenclature at genomic level (hg38) |
HGVS strict genomic (hg38): | NC_000007.14:g.117627651_117627652delinsG | HGVS full strict nomenclature at genomic level (hg38) |
pseudo VCF (hg38): | hg38-7-117627651-AA-G | chr-pos-ref-alt (hg38) |
Features | Values | Descriptions |
---|---|---|
Position in transcript: | Exon 22 | Exon/intron position in NM_000492.3 |
Position / splice site | 120 bp from donor | Position relative to the nearest splice site |
Position / protein | 1200 / 1479 | Position relative to the protein |
Position / domain | Not in a UNIPROT defined domain | Position in a protein domain (UNIPROT: P13569) |
Wild type sequence | GATTATTGAGAATTCACACGTGAAG AA AGATGACATCTGGCCCTCAGGGGGC | Wild type DNA sequence +/- 25 bp |
Mutant sequence | GATTATTGAGAATTCACACGTGAAG G- AGATGACATCTGGCCCTCAGGGGGC | Mutant DNA sequence +/- 25 bp |
Features | Values | Descriptions |
---|---|---|
gnomAD exome: | No match in gnomAD exome | v2.1.1 Exomes global MAF |
gnomAD genome: | No match in gnomAD genome | v2.1.1 Genomes global MAF |
gnomAD exome (non cancer): | No match in gnomAD exome | v2.1.1 Exomes MAX MAF for non-cancer dataset |
gnomAD v4 Genome: | No match in gnomADv4 Genome | v4.1.0 Genomes global MAF |
gnomAD v4 Exome: | No match in gnomADv4 Exome | v4.1.0 Exomes global MAF |
dbSNP rsid: | No match in dbSNP v156 | Identifier for NCBI dbSNP |
Clinvar Germline: | Pathogenic * | Clinvar interpretation |
ClinGen EvRepo: | Searching for ClinGen EvRepo data... | ClinGen Evidence Repository Classification for the variant |
GeneBe: | Asking GeneBe... | Semi-automated ACMG classification - click on the GeneBe link to adjust - passing the mouse over a criterion will display the definition |
LOVD matches: | Searching LOVD... | LOVD match in public instances |
Features | Values | Descriptions |
---|---|---|
CADD raw: | No match in CADD v1.6 | [-6.41;35.5] The higher the less likely to be observed |
CADD phred: | No match in CADD v1.6 | Phred-like scaling of raw score |
Eigen raw: | None | [-3.33;6.84] The higher the less likely to be observed |
Eigen phred: | None | Phred-like scaling of raw score |
MPA score: | 10 | Raw score [0;10], 10: high impact |
MPA impact: | Clinvar pathogenic | Impact type |
The exonic splicing context of the variant including natural splice sites scores is summarized in the graph below:
MaxEntScan scores are presented in the two following tables. Selected scores have:
Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
---|---|---|---|---|
No significant MaxEnt 5'ss scores found. |
Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
---|---|---|---|---|
No MaxEnt 3'ss score performed (exonic variant far form 3'ss). |
SPiP results and predictions:
MobiDetails is running SPiPv2 (may last up to 20s)...
Features | Values | Descriptions |
---|---|---|
spliceAI lookup (500) AG: | SpliceAi 500 was not run | Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
spliceAI lookup (500) AL: | SpliceAi 500 was not run | Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
spliceAI lookup (500) DG: | SpliceAi 500 was not run | Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
spliceAI lookup (500) DL: | SpliceAi 500 was not run | Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
SpliceAI-visual displays SpliceAI raw (absolute) predictions:
MobiDetails is running spliceai to bring you SpliceAI-visual...
Variant | User | Date | ACMG Classification* | Comments |
---|---|---|---|---|
NM_000492.3(CFTR):c.3598_3599delinsG
Current
|
CFTR-France | 2020-07-06 | Class 5 (pathogenic) |
To modify the classification history, you must be logged in (you might want to create an account before).
* We added an additional 'risk factor' class to the 5 ACMG classes in order to describe low penetrance risk factor variants. Currently, these variants are not sent to the LOVD Global Variome instance.
Features | Values | Descriptions |
---|---|---|
Creation user: | CFTR-France | User who created the variant |
Creation date: | 2020-06-15 | Date of creation in MD |
To contact the creation user, you must be logged in (you might want to create an account before).