IMPORTANT NOTICE:
MobiDetails' migration to the new instance is scheduled for March, 19th, morning. The current instance will first be placed on read-only mode during the switch, which should last a few hours, and which means you will be able to consult already annotated variants but not annotate new ones. A redirection to the new instance will be activated when it is ready.
This variant may be annotated on the current canonical isoform (NM_000492.4) using the following expression,
directly in the search engine at the bottom of the page or by using the blue button below:
NC_000007.14:g.117619460_117619463del;CFTR
Try annotation on the canonical NM_000492.4 Annotating the variant on NM_000492.4
| Features | Values | Descriptions |
|---|---|---|
| HGNC gene symbol (ID): | CFTR (1884) | HGNC gene symbol and corresponding ID |
| HGVS DNA on transcript: |
NM_000492.3:c.3468+4747_3468+4750del
RefSeq Select
|
HGVS full nomenclature at DNA level on transcript |
| IVS name: | IVS21+4747_IVS21+4750del | IVS nomenclature |
| HGVS RNA: | r.(?) | HGVS full nomenclature at RNA level |
| HGVS Protein: | NP_000483.3:p.(?) | HGVS full nomenclature at protein level |
| HGVS genomic (hg19): | chr7(hg19):g.117259514_117259517del | HGVS full nomenclature at genomic level (hg19) |
| HGVS strict genomic (hg19): | NC_000007.13:g.117259514_117259517del | HGVS full strict nomenclature at genomic level (hg19) |
| pseudo VCF (hg19): | hg19-7-117259511-ACTGT-A | chr-pos-ref-alt (hg19) |
| HGVS genomic (hg38): | chr7(hg38):g.117619460_117619463del | HGVS full nomenclature at genomic level (hg38) |
| HGVS strict genomic (hg38): | NC_000007.14:g.117619460_117619463del | HGVS full strict nomenclature at genomic level (hg38) |
| pseudo VCF (hg38): | hg38-7-117619457-ACTGT-A | chr-pos-ref-alt (hg38) |
| Features | Values | Descriptions |
|---|---|---|
| Position in transcript: | Intron 21 | Exon/intron position in NM_000492.3 |
| Wild type sequence | TGACAATTCAGTTTGTTTCACAACT GTCT ATCACATAGTGAGCACAACTAAAAG | Wild type DNA sequence +/- 25 bp |
| Mutant sequence | TGACAATTCAGTTTGTTTCACAACT ---- ATCACATAGTGAGCACAACTAAAAG | Mutant DNA sequence +/- 25 bp |
| Features | Values | Descriptions |
|---|---|---|
| gnomAD exome: | No match in gnomAD exome | v2.1.1 Exomes global MAF |
| gnomAD genome: | 0.0003 | v2.1.1 Genomes global MAF |
| gnomAD exome (non cancer): | No match in gnomAD exome | v2.1.1 Exomes MAX MAF for non-cancer dataset |
| gnomAD v4 Genome: | 0.0004 | v4.1.0 Genomes global MAF |
| gnomAD v4 Exome: | No match in gnomADv4 Exome | v4.1.0 Exomes global MAF |
| dbSNP rsid: | rs552815567 | Identifier for NCBI dbSNP |
| Clinvar Germline: | No match in Clinvar v20250227 | Clinvar interpretation |
| ClinGen EvRepo: | Searching for ClinGen EvRepo data... | ClinGen Evidence Repository Classification for the variant |
| GeneBe: | Asking GeneBe... | Semi-automated ACMG classification - click on the GeneBe link to adjust - passing the mouse over a criterion will display the definition |
| LOVD matches: | Searching LOVD... | LOVD match in public instances |
| Features | Values | Descriptions |
|---|---|---|
| CADD raw: | 0.048572 | [-6.41;35.5] The higher the less likely to be observed |
| CADD phred: | 1.669 | Phred-like scaling of raw score |
| Eigen raw: | None | [-3.33;6.84] The higher the less likely to be observed |
| Eigen phred: | None | Phred-like scaling of raw score |
| MPA score: | 0 | Raw score [0;10], 10: high impact |
| MPA impact: | Unknown | Impact type |
MaxEntScan scores are presented in the two following tables. Selected scores have:
| Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
|---|---|---|---|---|
| ... TCACATAGT
... ... TCAcatagt ... |
-16.49 | ... ATAGTGAGC
... ... ATAgtgagc ... |
3.48 | +121.1 |
| ... ATAGTGAGC
... ... ATAgtgagc ... |
3.48 | ... TGAGCACAA
... ... TGAgcacaa ... |
-17.13 | -592.24 |
| Wild-type sequence | Score | Mutant sequence | Score | Variation(%) |
|---|---|---|---|---|
| ... CACAACTGTCTATCACATAGTGA
... ... cacaactgtctatcacatagTGA ... |
3.78 | ... CACAACTATCACATAGTGAGCAC
... ... cacaactatcacatagtgagCAC ... |
-15.99 | -523.02 |
SPiP results and predictions:
MobiDetails is running SPiPv2 (may last up to 20s)...
This table presents dbscSNV and SpliceAI raw delta scores (max distance: 50 bp, for academic users), when available. You can also run spliceAI via the spliceAIlookup API using a distance of 500 bp, and get also raw delta scores. This may take a while especially for genes with multiple transcripts but may help you identify new deep intronic variants. This also gives the opportunity to get spliceAi scores for large insertions or deletions. Details on raw or masked delta scores are available here. While the authors state that masked scores are preferentially used for variant interprétation, raw scores (unmasked) seem to be more informative. You can get masked delta scores with a +/- 500 bp window with this link. For substitutions, a pre-computed score for AbSplice is diplayed when relevant. AbSplice associates SpliceAI, MMSplice and tissue-specific splice site annotations (SpliceMaps). The scores represent the probability that a given variant causes aberrant splicing in a given tissue.
| Features | Values | Descriptions |
|---|---|---|
| spliceAI AG: | 0.00 (6) | Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI AL: | 0.00 (16) | Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI DG: | 0.00 (-13) | Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI DL: | 0.00 (14) | Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) AG: | SpliceAi 500 was not run | Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) AL: | SpliceAi 500 was not run | Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) DG: | SpliceAi 500 was not run | Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
| spliceAI lookup (500) DL: | SpliceAi 500 was not run | Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2|0.5|0.8 for impact |
Values are normalised (0-1), 0 being the less damaging and 1 the most for each predictor.
SpliceAI-visual displays SpliceAI raw (absolute) predictions:
MobiDetails is running spliceai to bring you SpliceAI-visual...
| Variant | User | Date | ACMG Classification* | Comments |
|---|---|---|---|---|
| No classification defined yet for this variant |
To modify the classification history, you must be logged in (you might want to create an account before).
* We added an additional 'risk factor' class to the 5 ACMG classes in order to describe low penetrance risk factor variants. Currently, these variants are not sent to the LOVD Global Variome instance.
| Features | Values | Descriptions |
|---|---|---|
| Creation user: | CFTR-France | User who created the variant |
| Creation date: | 2020-06-19 | Date of creation in MD |
To contact the creation user, you must be logged in (you might want to create an account before).