NM_000492.3(CFTR):c.774A>C

IMPORTANT NOTICE:
MobiDetails' migration to the new instance is scheduled for March, 19th, morning. The current instance will first be placed on read-only mode during the switch, which should last a few hours, and which means you will be able to consult already annotated variants but not annotate new ones. A redirection to the new instance will be activated when it is ready. You can already note the new URL (currently unreachable): https://mobidetails.chu-montpellier.fr

Nomenclatures Positions Frequencies Predictions Splicing Missense Classification Admin info Cite

This variant may be annotated on the current canonical isoform (NM_000492.4) using the following expression,
directly in the search engine at the bottom of the page or by using the blue button below:
NC_000007.14:g.117536578A>C;CFTR

Try annotation on the canonical NM_000492.4 Annotating the variant on NM_000492.4

Nomenclatures

Features	Values	Descriptions
HGNC gene symbol (ID):	CFTR (1884)	HGNC gene symbol and corresponding ID
HGVS DNA on transcript:	NM_000492.3:c.774A>C RefSeq Select	HGVS full nomenclature at DNA level on transcript
HGVS RNA:	r.(?)	HGVS full nomenclature at RNA level
HGVS Protein:	NP_000483.3:p.(Arg258Ser)	HGVS full nomenclature at protein level
HGVS genomic (hg19):	chr7(hg19):g.117176632A>C	HGVS full nomenclature at genomic level (hg19)
HGVS strict genomic (hg19):	NC_000007.13:g.117176632A>C	HGVS full strict nomenclature at genomic level (hg19)
pseudo VCF (hg19):	hg19-7-117176632-A-C	chr-pos-ref-alt (hg19)
HGVS genomic (hg38):	chr7(hg38):g.117536578A>C	HGVS full nomenclature at genomic level (hg38)
HGVS strict genomic (hg38):	NC_000007.14:g.117536578A>C	HGVS full strict nomenclature at genomic level (hg38)
pseudo VCF (hg38):	hg38-7-117536578-A-C	chr-pos-ref-alt (hg38)

Mutalyzer

VariantValidator

HGVS website

Positions

Features	Values	Descriptions
Position in transcript:	Exon 7	Exon/intron position in NM_000492.3
Position / splice site	31 bp from acceptor	Position relative to the nearest splice site
Position / protein	258 / 1479	Position relative to the protein
Position / domain	ABC transmembrane type-1 1 (81 - 365)	Position in a protein domain (UNIPROT: P13569)
Position tolerance	1.65 : highly tolerant - Transcript view	MetaDome score, the closer to 0, the more intolerant to variation
Wild type sequence	AGAGAGCTGGGAAGATCAGTGAAAG A CTTGTGATTACCTCAGAAATGATTG	Wild type DNA sequence +/- 25 bp
Mutant sequence	AGAGAGCTGGGAAGATCAGTGAAAG C CTTGTGATTACCTCAGAAATGATTG	Mutant DNA sequence +/- 25 bp

requesting LitVar2 for Pubmed requires a dbSNP identifier

Export to DEFGEN (hg19)

Export to DEFGEN (hg38)

Population Frequencies and Databases

Features	Values	Descriptions
gnomAD exome:	No match in gnomAD exome	v2.1.1 Exomes global MAF
gnomAD genome:	No match in gnomAD genome	v2.1.1 Genomes global MAF
gnomAD exome (non cancer):	No match in gnomAD exome	v2.1.1 Exomes MAX MAF* for non-cancer dataset*
gnomAD v4 Genome:	No match in gnomADv4 Genome	v4.1.0 Genomes global MAF
gnomAD v4 Exome:	No match in gnomADv4 Exome	v4.1.0 Exomes global MAF
dbSNP rsid:	No match in dbSNP v156	Identifier for NCBI dbSNP
Clinvar Germline:	Uncertain significance *	Clinvar interpretation
ClinGen EvRepo:	Searching for ClinGen EvRepo data...	ClinGen Evidence Repository Classification for the variant
hg38 InterVar:	Asking Intervar...	Semi-automated ACMG classification - click on the intervar link to adjust - passing the mouse over a criterion will display the definition
GeneBe:	Asking GeneBe...	Semi-automated ACMG classification - click on the GeneBe link to adjust - passing the mouse over a criterion will display the definition
LOVD matches:	Searching LOVD...	LOVD match in public instances

exon substitution +

Overall predictions

Features	Values	Descriptions
CADD raw:	3.62	[-6.41;35.5] The higher the less likely to be observed
CADD phred:	25.10	Phred-like scaling of raw score
Eigen raw:	0.47	[-3.33;6.84] The higher the less likely to be observed
Eigen phred:	4.80	Phred-like scaling of raw score
MPA score:	10.0	Raw score [0;10], 10: high impact
MPA impact:	High missense	Impact type

Splicing predictions

Exonic context

The exonic splicing context of the variant including natural splice sites scores is summarized in the graph below:

MaxEntScan results

MaxEntScan scores are presented in the two following tables. Selected scores have:

a |variation| > 15% and
a raw score for mutant or wild-type of at least 3

The upper sequence shows the variation site in red, and the lower sequence the putative splice site considered by MaxEntScan (putative introns are shown as lower case and exons as upper case).

MaxEntScan 5'ss scores
Wild-type sequence	Score	Mutant sequence	Score	Variation(%)
		No significant MaxEnt 5'ss scores found.

MaxEntScan 3'ss scores
Wild-type sequence	Score	Mutant sequence	Score	Variation(%)
		No MaxEnt 3'ss score performed (exonic variant far form 3'ss).

SPiP results

SPiP results and predictions:

MobiDetails is running SPiPv2 (may last up to 20s)...

dbscSNV / SpliceAI / AbSplice Max results

This table presents dbscSNV and SpliceAI raw delta scores (max distance: 50 bp, for academic users), when available. You can also run spliceAI via the spliceAIlookup API using a distance of 500 bp, and get also raw delta scores. This may take a while especially for genes with multiple transcripts but may help you identify new deep intronic variants. This also gives the opportunity to get spliceAi scores for large insertions or deletions. Details on raw or masked delta scores are available here. While the authors state that masked scores are preferentially used for variant interprétation, raw scores (unmasked) seem to be more informative. You can get masked delta scores with a +/- 500 bp window with this link. For substitutions, a pre-computed score for AbSplice is diplayed when relevant. AbSplice associates SpliceAI, MMSplice and tissue-specific splice site annotations (SpliceMaps). The scores represent the probability that a given variant causes aberrant splicing in a given tissue.

Features	Values	Descriptions
dbscSNV ADA:	No match in dbscSNV v1.1	Raw score 0-1, threshold ≥ 0.8 for impact
dbscSNV RF:	No match in dbscSNV v1.1	Raw score 0-1, threshold ≥ 0.8 for impact
spliceAI AG:	0.00 (-30)	Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI AL:	0.00 (-28)	Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI DG:	0.00 (3)	Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI DL:	0.00 (-28)	Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI lookup (500) AG:	SpliceAi 500 was not run	Acceptor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI lookup (500) AL:	SpliceAi 500 was not run	Acceptor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI lookup (500) DG:	SpliceAi 500 was not run	Donor Gain, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
spliceAI lookup (500) DL:	SpliceAi 500 was not run	Donor Loss, Δ score 0-1 (relative position in bp), thresholds ≥ 0.2\|0.5\|0.8 for impact
AbSplice:	< 0.01 in v1.0.0 (dataset)	AbSplice Max Tissue score, thresholds ≥ 0.01\|0.05\|0.2 for impact

Show radar chart

SpliceAI-visual results

MobiDetails is running spliceai to bring you SpliceAI-visual...

Missense predictions: p.(Arg258Ser)

Features	Values	Prediction	Descriptions
SIFT:	0.0	Damaging	Threshold < 0.05 for Damaging - single score
Polyphen 2 HumDiv:	1.0	Probably Damaging	Thresholds ≥ 0.454\|0.957 for Possibly and Probably Damaging - single score
Polyphen 2 HumVar:	0.997	Probably Damaging	Thresholds ≥ 0.447\|0.909 for Possibly and Probably Damaging - single score
Fathmm:	-2.52	Damaging	Threshold ≤ -1.5 for Damaging - single score
AlphaMissense:	0.979	Likely Pathogenic	Thresholds 0.34\|0.564 for Likely Benign, Ambiguous, Likely Pathogenic - single score
REVEL:	0.866	Damaging	Thresholds 0.2\|0.5 for Benign, Uncertain, Damaging - meta score
ClinPred:	0.993	Damaging	Threshold ≥ 0.5 for Damaging - meta score
Meta SVM:	0.5986 (10)	Damaging	Threshold ≥ 0 for Damaging (reliabilty index: 0-10), 10:high - meta score
Meta LR:	0.7991 (10)	Damaging	Threshold ≥ 0.5 for Damaging (reliabilty index: 0-10), 10:high - meta score
Mistic:	0.78	Damaging	Threshold ≥ 0.5 for Damaging - meta score

Show radar chart

3D Modeling: p.(Arg258Ser)

Let's try this direct access to MIZTLI's 3D engine to compare the wild-type and mutant structure of your variant.

Classification History

Variant	User	Date	ACMG Classification*	Comments
NM_000492.3(CFTR):c.774A>C Current	CFTR-France	2020-06-18	Class 3 (uncertain significance)	None

To modify the classification history, you must be logged in (you might want to create an account before).

* We added an additional 'risk factor' class to the 5 ACMG classes in order to describe low penetrance risk factor variants. Currently, these variants are not sent to the LOVD Global Variome instance.

Administrative information

Features	Values	Descriptions
Creation user:	CFTR-France	User who created the variant
Creation date:	2020-06-15	Date of creation in MD

To contact the creation user, you must be logged in (you might want to create an account before).

Resource	Version	Reference
AbSplice	v1.0.0 (dataset)	Wagner et al., 2023
AlphaMissense	v20230803 (dataset)	Cheng et al., 2023
CADD	v1.6	Rentzsch et al., 2019
ClinGenSpecificationRegistry	v20250304	None et al., None
ClinPred	2018_hg19	Alirezaie et al., 2018
ClinVar	v20250227	Landrum et al., 2016
dbMTS	v1.0	Chang et al., 2020
dbNSFP	v4.3a	Liu et al., 2016
dbscSNV	v1.1	Jian et al., 2014
dbSNP	v156	Sherry et al., 2001
EpiSignature	v20210901	Foroutan et al., 2021
Eigen	v1.1	Ionita-Laza et al., 2016
FatHMM	from dbNSFP	Shihab et al., 2013
genebe	Live web site	Stawinski et al., 2024
gnomAD	v2.1.1;v3.1.2;v4.1.0	Karczewski et al., 2020
HexoSplice	Live web site	Tubeuf et al., 2020
InterVar	API	Li et al., 2017
LitVar2	API	Allot et al., 2018
LOVD	API	Fokkema et al., 2011
MaxEntScan	2004	Yeo et al., 2004
MetaDome	v1.0.1	Wiel et al., 2019
MetaSVM-LR	from dbNSFP	Dong et al., 2015
Mistic	v1	Chennen, Weber et al., 2020
MIZTLI	Live web site	Blavier et al., 2022
MorfeeDB	1.0	Tregouet et al., 2023
MPA	1.1	Yauy et al., 2018
MuPIT	API	Niknafs et al., 2013
Mutalyzer	API	Wildeman et al., 2008
mygene.info	API	Xin et al., 2016
OncoKBGenes	v20221213	Chakravarty et al., 2017
panelApp	API	Stark et al., 2021
Polyphen-2	from dbNSFP	Adzhubei et al., 2010
regulomeDB	Live web site	Boyle et al., 2012
REVEL	1.3	Ioannidis et al., 2016
SIFT	from dbNSFP	Ng et al., 2003